Furthermore, the impact of internal microscopic force generated in the abrupt intense cooling processes on the MNBS texture of the PTFE/PPS superhydrophobic coatings was investigated systematically. A stretching force (Fs) was generated in the natural crystallization process for the continuous zone in Q1, Q2, and Q3 coating [31]. In addition, another tensile force (F T) was applied on the respective selleck chemicals macromolecular

chains in the continuous zone in Q1, Q2, and Q3 coating under quenching interference, as shown in Equation 2. (2) Where E is Young’s modulus, a l is coefficient of linear expansion, and T 0 and T 1 are the initial and final temperatures, respectively [34]. The force F T was derived from the intense see more shrinkage of surrounding macromolecular chains on the cooling process. As the temperature decreased at the same rate for the continuous zones during the whole quenching (crystallization) processes, Fs and F T were at the equilibrium state, respectively (ΣFs ≈ 0, ΣF T ≈ 0); therefore, the crystallization of polymer chains at continuous zone of Q1, Q2, and Q3 coating was in an unconstrained selleck chemicals llc environment similar with P1 coating. However, the crystal growth of polymer chains was different because crystallization time of Q1, Q2, and Q3 coating was much shorter than P1 coating (Table  1). Therefore, only nano-spheres/papules formed in the continuous zone

for Q1, Q2, and Q3 coating. Moreover, increasing the cooling rate gradually from Q1 to Q3 coating (Table  1) resulted in a MG 132 size reduction of polymer nano-spheres with a higher degree of overlap. On the other hand, for the discontinuous zone of Q1, Q2, and Q3 coating (Figures  4 and 5) between the porous gel network and micropapillae, the nucleation and crystal growth of polymer

chains were promoted because of high interfacial energy [33]. At the same time, the cooling time in the discontinuous zone was longer than the continuous zone because of less exposure in the cooling medium. Although a tensile force (F T) was generated by the uneven shrinkage from adjacent continuous phase of the coatings under the quenching interference [35–37], F T was much smaller than the critical value (F cr) for both Q1 and Q2 coating. Thus, the crystallization process of polymer chains was dominated by the crystallization driving force and crystallization time [32, 38]; therefore, nano-willow and nano-fiber segments were obtained in the discontinuous zone of Q1 coating, while nano-spheres/papules coexisted with smaller nano-fiber segments in the discontinuous zone of Q2 coating. However, when Q3 coating was quenched in a non-uniform medium interference, the polymer chains at discontinuous zone suffered much larger tensile force F T than the discontinuous zone of Q1 and Q2 coating, due to the significant temperature difference between the continuous zone and discontinuous zone (Table  1).

For ELISA analysis, raw cells were treated as described above and conditioned medium or cell lysates were used to determine concentrations of TNFα (Cat. No. KMC3011,

Invitrogen), and IL-1β (Cat. No. MLB00B, ARS-1620 cell line Quantikine), according to the manufacturer’s instructions. Nitric oxide assay Nitrite concentration in conditioned media was measured by Griess Reagent (Cat. No. G2930, Promega) according to the manufacturer’s instructions. Quantitative Real-Time PCR Total RNA was isolated from cell pellets using Trizol (Cat. No.15596-018, Invitrogen) as per manufacturer’s instruction. RNA was resuspended in 50 μL of DEPC treated water and stored at -80°C. RNA concentration and purity was determined by spectrophotometry at 260 and 280 nm. Reverse transcription was performed using qScript cDNA super mix (Cat No. 95048-100, Quanta Biosciences). PCR was conducted by using Fast SYBR Green Master Mix (Cat No. 4385612,

AB Applied ISRIB order Biosystems) on an Applied Biosystems Step One Plus Real-time PCR system. The relative number of each transcript copy was normalized by house-keeping gene Beta Actin. Real-time PCR primers used were as follows: NOS2 selleck kinase inhibitor forward, CACCTTGGAGTTCACCCAGT; NOS2 reverse, ACCACTCGTACTTGGGATGC; COX2 forward, CCCCCACAGTCAAAGACACT; COX2 reverse, CTCATCACCCCACTCAGGAT; TNFα forward, AGAAGTTCCCAAATGGCCTC; TNFα reverse, GTCTTTGAGATCCATGCCGT; IL-1β forward, TGTGAAATGCCACCTTTTGA; IL-1β reverse, TGAGTGATACTGCCTGCCTG. Clinical Samples Serum from a previously reported CRC patient and control population originating from Chiba University was equally pooled [17]. Ethyl-acetate extracts CHIR-99021 of the pooled control and CRC serum were subject to HPLC-coupled tandem mass

spectrometry to determine relative GTA levels as previously described [17]. Statistical Methods Where data is averaged, error bars represent 1 standard deviation (S.D.) of the mean. Significance was determined if p < 0.05 using unpaired Student’s T test (Microsoft Excel). Results Treatment of cells with un-enriched human serum extracts We first determined whether crude serum ethyl acetate extract, prior to chromatographic enrichment of GTAs, would have any effect on cellular growth by treating cells with commercially available bulk human serum extracts (see methods). The total ion chromatogram (TIC) of the organic fraction following HPLC-coupled time-of-flight (TOF) mass spectrometry is shown in Figure 1A. The extracted mass spectra of the complete TIC is shown in Figure 1B, which was dominated by various free fatty acids but contained detectable levels of GTAs including those with masses of 446 (C28H46O4), 448 (C28H48O4) and 450 (C28H50O4) Da (Figures 1B and 1C). By calculating the peak areas of the three chromatograms, we estimated that these three GTAs represented no more than 0.15% of the total ion current in the sample.

It is conceivable that the modified avidin coating protocol using citrate buffer altered the charge selleck chemicals llc distribution at the steric layer, thus augmenting the negative surface charge of avidin-coated SPIONs. With the introduction of the negatively charged DPPG into the lipid mixture, charge repulsion may have resulted

in less tight association of the lipid layer with the avidin-coated Fe3O4 surface. Further assessment of the nanoassembly using AZD2014 high-resolution transmission electron microscopy (HRTEM) and atomic force microscopy could provide additional experimental support for this hypothesis. Nevertheless, it is relevant to emphasize that DLS measurements are performed in the presence of a liquid suspension vehicle (e.g., citrate buffer) and determine hydrodynamic particle size distributions. HRTEM requires dry samples and may result in different quantitative size information due to the absence of a surface-associated hydration layer. The incorporation of a 50% molar ratio of DPPG into the lipid layer effectively augmented the negative surface charge of the lipid coat from -5.0 [12] to -19.1 mV. The enhanced negative charge associated with the nanoparticle surface is expected to increase colloidal stability

of the suspension. Furthermore, it is predicted that this favorable zeta potential reduces surface adsorption of selleck serum components such as proteins and lipoproteins [25]. Ultimately, these improved physicochemical properties of lipid-coated

SPIONs may significantly increase biological circulation time after systemic administration allowing more effective delivery of therapeutic payload to desired target cells. Magnetically induced hyperthermia The objective of immobilizing a phospholipid layer onto the surface of SPIONs was to fabricate a thermoreponsive nanoassembly that facilitates stimulus-induced release of a lipid-encapsulated payload following exposure to a localized alternating magnetic field. Heating behavior of uncoated and lipid-coated SPIONs was first assessed in the MFG-1000, which represents a user-friendly commercial device for the assessment of hyperthermia up to 7.0 mT at O-methylated flavonoid 1.0 MHz. It allows simple measurements using 200-μL PCR tubes or glass slides. However, this device has limited suitability for cell-based experiments and cannot be used for preclinical animal experiments. Therefore, it was of interest to compare heating behaviors of these SPIONs in the MFG-1000 with results from an experimental MHS built in our laboratory that was designed to explore the magnetically induced hyperthermia effect on biological systems, including adherent cell lines and small animals such as mice and rats. Figure 2 compares time-dependent temperature profiles recorded upon exposure of lipid-coated SPIONs at a concentration of 0.02 mg/mL in citrate buffer, pH 7.4, to a 7-mT magnetic field alternating at 1.0 MHz (MFG-1000) and a 16.6-mT magnetic field at 13.6 MHz (MHS).

Moreover, there are few fluorescent selleck kinase inhibitor proteins or dyes the excitation wavelengths of which do not coincide with those of carotenoids and chlorophylls. Because the resolution limit of optical microscopy is ∼200 nm, and due to the difficulties in tagging Selleck H 89 proteins of interest, protein organization in the thylakoid membrane cannot be currently resolved through confocal optical microscopy. As a result, electron microscopy (EM) and atomic force microscopy (AFM), which are more invasive than optical microscopy and can resolve features on a short length scale, have been used to image the thylakoid

membrane (Dekker and Boekma 2005; Kirchhoff et al. 2008b). EM imaging of A. thaliana has recently been used to understand the arrangement of proteins https://www.selleckchem.com/products/PLX-4032.html in the thylakoid (Boekma et al. 2000; Dekker and Boekma 2005; Kouřil et al. 2012a). Thylakoid membranes are isolated and then negatively stained for contrast. Betterle and coworkers observed that the distance between

PSII centers decreased during acclimation in wild type A. thaliana but not in the npq4 mutant (Betterle et al. 2009). Another common EM technique is freeze-fracture EM, in which thylakoids are frozen and then split along the lipid bilayer such that the transmembrane proteins remain on one side of the split membrane (for review, see Staehelin 2003). Using freeze-fracture EM, the Ruban group observed clustering of the LHCs on the timescales of qE induction (Johnson et al. 2011). One drawback of

using these EM techniques is the intensive sample preparation that is required. Negative staining requires fixing and dehydrating the grana, and freeze-fracture images are made with metallic replicas made from the frozen samples. In this way, the sample preparation techniques may impact the arrangement of proteins (Kirchhoff et al. 2008b). To cope with these experimental drawbacks, there has recently been effort to use cryo EM and tomography to image unstained spinach and pea chloroplasts. In cryo EM, thylakoids or chloroplasts are flash frozen triclocarban at cryogenic temperatures to create vitreous samples that can then be sectioned (Dall’Osto et al. 2006; Kouřil et al. 2011). The advantage to cryo EM is that the samples remain hydrated, with the water in the sample forming a non-crystalline, vitreous ice. This technique has allowed Kouřil to examine the native 3D structure of the grana membrane and the arrangement of PSII within the membrane (Kouřil et al. 2012b). Although there are some experimental challenges associated with cryo EM (Daum et al. 2010; De Carlo et al. 2002), it shows much promise for future use in studying the organization of proteins in the chloroplast before and during qE. In addition to EM-based techniques, researchers have imaged thylakoid membranes using AFM. In AFM, samples are placed on a mica surface exposed to air and probed with a cantilever. An image is created using the height of the sample for contrast (Kirchhoff et al. 2008b).

Discussion After almost two centuries of performing appendectomies, Combretastatin A4 clinical trial surgeons started resecting the inflamed appendix laparoscopically in the late 1980′s. Whether the laparoscopic approach is superior, equivalent or inferior to the open approach in terms of outcomes remains controversial. Several trials have consistently showed that LA, despite being associated with a longer operative time, provides patients with a faster recovery and earlier return to routine activities when compared to OA [1–6]. In a systematic review of randomized trials conducted by Sauerland et al, the rate of superficial surgical site infection was

decreased by half, but the rate of deep surgical site infections (intra-abdominal selleck MK5108 abscesses) was three times higher

in LA as compared to OA [5]. On the other hand, a more recent study that used the Nationwide Inpatient Sample database from 2000 to 2005 suggested that the overall rate of complications is 7% higher with LA [9]. This same study of more than 132,000 appendectomies also found that the cost of LA was 22% higher than OA in uncomplicated appendicitis and 9% higher in complicated appendicitis. More importantly, laparoscopy has been associated with a 0.1 to 1% risk of intra-abdominal or retroperitoneal injuries, including major vessel injury [10–12]. Most of these injuries have been reported to occur during the initial trocar or Veress needle insertion, and many resulted in major morbidity to the patient. Whether LA or OA is the “”standard”" treatment for acute appendicitis remains controversial, and resolving that matter will probably require rigorous valuation (assigning “”values”" to the severity of specific complications) and severity weighting of the complication profile of each approach in the setting of a randomized trial [13]. The appendix is reported to be “”hidden”" in a retroperitoneal, retroileal, only retrocecal or retrocolic location in up to 30% of cases [14]. The terms retrocecal, retroperitoneal

and retrocolic have been and continue to be used in literature interchangeably. However, in a 1938 report, William B. Marbury defined retrocecal as being limited by the caput cecum and retrocolic as extending superiorly posterior to the ascending colon [15]. Most retrocolic appendices are also retroperitoneal, while most retrocecal appendices are intraperitoneal. The patient we report in this paper had a major vascular retroperitoneal injury resulting in significant hemorrhage. The injury likely resulted from avulsion of the retroperitoneal gonadal vessel during dissection of the inflamed retrocolic appendix rather than from a trocar or Veress needle insertion. Marbury, in his landmark 1938 paper, reported on one patient with a retrocolic appendix who suffered “”troublesome”" bleeding subsequent to injury to a branch of the ileocecal artery [15].

Statistical analysis Statistical method of RG-7388 the factor analysis was used to extract the risk aspects for the patients (Statgraphics Centurion XVI, StatPoint Technologies, Inc. Warrenton, USA). Then, the clinical value

of the extracted factors was evaluated by ANOVA, where the treatment outcome was investigated. Variances were checked by Levene’s test. As p value for this statistics was less than 0.05, Kruskal-Wallis Test was applied to check the significance. Finally, the number of significant preoperative factors for the prognosis was reduced to 8 parameters which were grouped into 3 prognostic factors named respectively: proteinic status, inflammatory status and general status arranged dependently on their statistical power. All utilized parameters can be collected in a simple way during examination of the patient directly after admission to the ward and after laboratory investigations (selleck kinase inhibitor within 2–3 hours). The first factor explained as “proteinic

status” informs about the initial state of protein metabolism. This parameter is composed of results of laboratory tests of blood: serum protein, albumin and hemoglobin (HGB) level. The second factor “inflammatory status” allows to estimate the patient’s septic state on the basis of three laboratory parameters determined prior to the treatment: white blood cell count (WBC_pre), CRP value (CRP_pre), PCT value (PCT_pre). The third factor of the prediction schema “general risk” focuses on the evaluation of the patient’s clinical state and includes Pevonedistat only two important parameters: age (Age) and the number of coexisting diseases (Coex_disease). Coefficients of sensitivity (SNC) and specificity (SPC) were calculated for the extracted

factors to check the prediction power of the suggested method. The proposed method is designed for the prediction of recovery. Thus, the result of the test is positive (P) if the test predicts the recovery, and negative very (N) if the test does not predict the recovery but i.e. “death”. Respectively, the result of the test is true (T) if the test predicts recovery when the observed result is “recovery”, and the result of the test is false (F) if the test does not predict the recovery. Therefore: TP-patient recovered and predicted as “recovery”, TN-patient died and predicted as “death”, FP-patient died but predicted as “recovery”, and FN – patient recovered but predicted as “death”. Basing on the above definitions, the suggested sensitivity and specificity coefficients equations are: Sensitivity coefficient: Specificity coefficient: Results Three factors have been extracted as statistically requested (Eigenvalue > 1), they are presented in Table 3. Together they account for over 69% of the variability in the original data.

Peak at 4474 Da was significantly higher in GC (lower panel), compared with non-cancer controls (upper panel). Wilcoxon Rank Sum p < 0.001. To explore if the prognosis biomarkers also play a role in GC progression, 19 patients with stage I+II and 24 with stage III+IV from Group 1 were analyzed for stage discrimination. Overall, 36 peaks were qualified and finally 6 peaks at 4474, 4060, 3957, 9446, 4988 and 5075 Da, respectively, constructed the stage discriminating pattern (see Additional file 1). This pattern could discriminate stage III+IV with 79.2% (19/24) sensitivity and 78.9% (15/19) specificity, while CEA only achieved 50.0% (12/24) and 84.2% (16/19), respectively CBL0137 in vitro (Table 1). The area under

ROC curve was 0.800 (95% CI, 0.661 to 0.939) for the established pattern and 0.753 (95% CI 0.60~0.90) for CEA (Fig 2C). Interestingly, peak at 4474 Da was also the most powerful biomarker

for GC stage discrimination with ROC of 0.732 (95% CI, 0.576 to 0.889, Wilcoxon Rank Sum p = 0.01) and with significantly higher expression level in stage III+IV (Fig 6). Figure 6 Representative expression check details of the peak at 4474 Da (red) in stage pattern. Peak at 4474 Da was significantly higher in stage III+IV GC (lower panel), compared with stage I/II GC (upper panel). Wilcoxon Rank Sum p = 0.01. Discussion GC is a heterogeneous disease and survival benefits could be gained through early detection and intensive post-operative treatment for selected patients. Evidence from large randomized controlled

trails supported TNM stage is the most important index for postoperative Silibinin treatment. Yet inferior survival benefit made the majority of patients over treated and we urgently need robust prognostic biomarker to alter this fatal outcome. Unfortunately, despite efforts with pharmacogemomics or gene-expression data, biomarkers with high and reliable predictive value for GC prognosis are still unavailable. Intrinsic genetic heterogeneity of GC have supported that panels of multiple biomarkers may improve the predictive efficiency. Serum proteomics conducted by SELDI-ProteinChip platform with bioinformatics to associate complex patterns with disease has been attractive, as it is easily accessible, non-invasive and clinically applicable. Novel biomarkers detected by such approach have been reported in various tumors, including prostate cancer [18, 19], ovarian cancer [20, 21], brain cancer [22], colorectal cancer [23, 24], breast cancer [25, 26], lung cancer [27] and GC [28]. This approach has yielded informative biomarker profiles in cancer detection with higher sensitivity and specificity, but none of these studies have investigated the https://www.selleckchem.com/products/Temsirolimus.html correlation between serum protein profiles with prognosis of GC [29]. Though many efforts have been devoted to improve early detection of GC, the majority of patients were diagnosed at advanced stage.

Specific pathogen free hens (SPF) were kept in strict hygienic conditions and were certified free of pathogens as determined by the control procedure of the experimental BAY 63-2521 datasheet infectiology selleck platform (PFIE-FE-0172). Our conventional

hens were issued from the same line and flock than SPF hens but were reared with commercial laying hens at 16 weeks for 10 weeks before egg sampling. However, they have not been vaccinated against virulent microorganisms as carried out for commercial birds. Gene expression in jejunum and caecum by RT-qPCR To better appreciate the immunological status of the three experimental groups, we first investigated the expression of interleukin-1 beta (IL-1β), interleukin-8 (IL-8) and Toll-like receptor-4 (TLR4) genes in the jejunum and the cæcum, as presented in Figure 1. In the jejunum, there was a 1.8- and 2.3-fold increase in IL-1β gene expression (Figure 1A), in C (p < 0.005) and SPF groups (p < 0.05), compared to GF. Similarly, the IL-8 gene (Figure 1B) expression was 3.7 and 4.2 times higher in C and SPF groups as compared to GF group (p < 0.05 and p < 0.005, respectively). LY294002 However, no statistically significant difference was observed between C and SPF for both IL-1β and IL-8 in the jejunum. The TLR4 expression levels remained similar amongst the three experimental

groups. Figure 1 Gene expression levels in the jejunum and the caecum of GF, SPF and C groups.

In the jejunum, the gene expression levels of IL-1β and IL-8 (A and B respectively) were higher in C and SPF as compared to GF. In the cæcum, IL-1β and IL-8 were ever overexpressed in C group as compared to SPF and GF. IL-8 and TLR4 mRNA level were also higher respectively in SPF and C groups compared to GF. (n = 8; mean ± standard deviation;*p < 0.05; **p < 0.01; ***p < 0.001). IL-1β and IL-8 data (A, B, D, E) were analysed using the Kruskal-Wallis test followed by the Mann–Whitney test; TLR4 data (C, F) were analysed using one-way ANOVA followed by the Bonferroni-Dunn test. In the cæcum (Figures 1D, E, F), IL-1β was overexpressed in the C group by more than 6- and 13-fold as compared to SPF (p < 0.01) and GF (p < 0.005), respectively. The mRNA levels between these latter groups were similar. The IL-8 gene expression was also higher in the C group as compared to both SPF and GF groups. IL-8 expression was higher in C hens by more than 19-fold (versus SPF, p < 0.005) and 64-fold (compared to GF, p < 0.001). The SPF group demonstrated higher IL-8 mRNA levels (elevated more than 3-fold) compared with GF (p < 0.01). Finally, the TLR4 gene expression was higher in conventional hens (C) (1.6 fold; p < 0.05) as compared to GF hens, but not different from SPF hens. Egg white antibacterial activity The growth curves obtained after cultivating S. aureus, S. uberis, L. monocytogenes, S. Enteritidis, S.

Plasmids were extracted from overnight samples using QIAprep Spin Mini Prep kit (Qiagen, Sussex, UK) according to the manufacturer’s instructions and sent for Sanger sequencing (Source BioSciences, Dublin, Ireland). Bioinformatic analysis Following Sanger sequencing, sequence

reads were analysed using the NCBI protein database (BlastX; (http://​blast.​ncbi.​nlm.​nih.​gov/​)). In the event where multiple hits occurred, the BLAST hit which displayed greatest homology is reported. Results and discussion A PCR-based approach highlights the presence of β-lactamase gene homologues in the gut microbiota The results of the β-lactamase-specific PCRs demonstrated the presence and diversity of class 2 β-lactamase genes in the gut microbiota of healthy adults (Table 2[32]). Of the β-lactam primers used, the primers designed Copanlisib order to amplify bla TEM genes yielded the greatest number of unique sequence hits (42% of selected TOPO sub-clones gave a unique hit). The majority of these STI571 mouse genes exhibited a high percentage identity with genes from various members of the Proteobacteria including E. coli, Klebsiella, Salmonella, Serratia, Vibrio parahaemolyticus and Escherichia vulneris. The resistance of strains of Salmonella and Serratia to β-lactams via bla TEM genes has been noted [33–35] and such strains have been associated with nosocomial infections [36]. In contrast, there have been relatively

few studies of bla TEM genes in Vibrio parahaemolyticus and Escherichia vulneris[37, 38]. The identification of genes homologous to those from Enterobacteriaceae is not surprising given the prevalence of resistance genes among

members of this family [12]. It was notable that the bla TEM primers also amplified genes that resembled bla TEM genes from some more unusual sources, including two genes from Niclosamide uncultured bacteria and from a Sar 86 cluster (a divergent lineage of γ-Proteobacteria) bacteria. This approach can thus learn more provide an insight into possible novel/unusual sources of resistance genes, including those that culture-based approaches would fail to detect. Such results also highlight that had initial screening for resistant isolates been completed prior to PCR amplification of the resistance genes, such unusual sources of resistance genes may have been overlooked. Additionally, genes encoding ESBLs, including bla TEM-116, bla TEM-195 and bla TEM-96 amongst others, were also identified, with their closest homologues being members of the Proteobacteria (Table 2). Table 2 Homologues of β-lactamase genes detected in the human gut microbiota via PCR techniques Accession # Gene description Closest homologue E value % identity Bla TEM         ADE18890.1 β-lactamase TEM-1 S. enterica subsp. enterica 5e-154 99 AAS46844.1 β-lactamase TEM-1 S. marcescens 2e-156 100 AEN02824.1 β-lactamase TEM-1 K. pneumoniae 3e-111 99 AEN02817.

16 [22, 24]. f c of the CCTO/Au system was larger than the calculated value (0.16). However, the critical exponent (q ≈ 0.55) was lower than the lower limit of the normal range (q ≈ 0.8 to 1), indicating a slow increase in ϵ′ with increasing metal content.

Deviation of f c and q from percolation theory may be due to the agglomeration of Au NPs to form large Volasertib Au particles in the CCTO matrix, as clearly seen in Figure 2d. f c of the CCTO/Au system is comparable to those observed in the Ba0.75Sr0.25TiO3/Ag (f c = 0.285) [9] and BaTiO3/Ni (f c = 0.232 to 0.310) [4, 7] microcomposite systems. In the cases of the nanocomposite systems of PbTiO3/Ag [8] and Pb0.4Sr0.6TiO3/Ag [11], f c values were found to be 0.16. Actually, the obtained f c and q might not be highly accurate values or not the best values due to a large range of Au NPs volume fraction Selumetinib between 0.1 and 0.2. However, one of the most important factors for the observed higher f c click here for the CCTO/Au system clearly suggested a morphology transition from nanocomposite to microcomposite as Au NP concentration was increased to 20 vol.%. This result is consistent to the microcomposite systems of Ba0.75Sr0.25TiO3/Ag [9] and BaTiO3/Ni [4, 7]. Generally, the distribution of fillers in a matrix has

an influence on the value of f c. For spherical fillers, f c of randomly distributed ID-8 fillers is given by the ratio between the particle size of the matrix phase (R 1) and the filler (R 2) [22]. When R 1/R 2 ≈ 1 or R 1 ≈ R 2, we obtain f c  ≈ 0.16. As R 1/R 2 > > 1 or R 1 > > R 2, the fillers fill the interstitial space between the matrix phase particles, resulting in a continuous percolating cluster of the filler at f c  < 0.16.

As shown in Figure 2, the particle size of CCTO (R 1) is larger than that of Au NPs (R 2), i.e., R 1/R 2 > > 1. Theoretically, f c of the CCTO/Au NP system should be lower than 0.16. However, the observed f c value in the CCTO/Au system was found to be 0.21. Therefore, it is strongly indicated that the primary factor that has a great effect on f c is the agglomeration of the Au filler. Figure 3 The dependence of Au volume fraction on ϵ′ at RT for CCTO/Au nanocomposites. The symbols and solid curve represent the experimental data and the fitted curve, respectively. Insets 1 and 2 show the frequency dependence of ϵ′ at RT and tanδ (at 1 kHz and RT) of CCTO/Au nanocomposites. Large increases in ϵ′ of percolating composites are generally attributed to formation of microcapacitor networks in the composites and/or Maxwell-Wagner polarization [4, 9, 22]. For pure CCTO ceramics, the giant dielectric response is normally associated with the mean grain size [16, 17, 25].