tuberculosis. In addition, we showed that this role in the virulence for Mce2R regulon takes place in part through interfering with the normal maturation of phagosomes. However, further research is needed to better understand the mechanisms of regulation exerted by Mce2R and the role of Mce2R regulon in the survival of M. tuberculosis inside the host. Methods Ethical statement Animal experimentations were performed inside the biosafety facilities of the National Institute of Agricultural Technology (INTA), Argentina, in compliance with the regulations of Institutional Animal Care and Use Committee (CICUAE) of INTA (file number: 31-20-12). CICUAE’s members: Florestán Maliandi (President),

Alejandra Romera (Secretary), Marisa Farber, Analía Berinstein, Pablo Chacana, Gabriel Pinto, Bibiana Brihuega, Gisella Marcoppido, Verónica BMN 673 supplier Maldonado May, Lucas Vagnoni, LCZ696 Osvaldo Zabal and Luis Samartino (Vocals). Bacterial strains and culture media All cloning steps were performed in Escherichia coli HB101. E. coli were grown either in Luria-Bertani (LB) broth or on LB agar. M. tuberculosis strains were grown in Middlebrook 7H9 medium supplemented with albumin 0.5%, dextrose 0.4%, and glycerol 0.5% (M7H9-AD-G) and either Tween 80 0.05% or Middlebrook 7H11, supplemented with albumin, dextrose and glycerol. When necessary,

either 50 μg/ml hygromycin or 20 μg/ml kanamycin was added to the media. Construction of M. tuberculosis Δmce2R mutant and complemented strains A mutant strain of M. tuberculosis SCH772984 research buy carrying a chromosomal deletion encompassing

the bases 137–617 of the mce2R (Rv0586) gene was obtained by using the gene knockout system described by Bardarov [18]. Briefly, two DNA fragments of approximately 1 kb flanking the 5′ and 3′ regions of mce2R were obtained by PCR using M. tuberculosis H37Rv genomic DNA as template and the following sets of primers: Regionup-up (tctagaccgtacaactcgatcaat)/Regionup-low (tctagaactccgagcaactcagcc) and Regionlow-up (actagtatctgctcaggtgatccc)/Regionlow-low (actagtacgccgatcgtggtcaac). Flanking arms were directionally cloned into XbaI and SpeI sites Oxalosuccinic acid of cosmid pYUB854 [14]. The recombinant cosmid was digested by PacI and ligated to PacI-digested concatemerized DNA of phage phAE87. To generate each specialized transducing phage, the PacI-digested recombinant cosmid was used to replace cosmid pYUB328 in phAE87 an in vitro λ-packaging reaction (GIGAPackII, Stratagene). After transducing E. coli HB101 and plating the transductants on selective media containing hygromycin. Phasmid DNA was prepared from the pooled antibiotic-resistant transductants and electroporated into M. smegmatis mc2155. Transductants were grown at the permissive temperature of 31°C to allow phage replication, and then transducing phages were prepared from isolated plaques as previously described [18].