PCR primers were designed to amplify the known virulence factors BAY 80-6946 of S. gallolyticus fimB and gtf and to amplify a homolog of the pilB gene identified in S. suis (Table 2). DNA amplification was carried out in 0.2 mL tubes containing 45 μL reaction mix and 5 μL DNA extract. The reaction mix consisted of 1× Selleck GF120918 HotMaster Taq buffer including 2.5 mM MgCl2, 200 μM of each dNTP, 100 nM of each primer and 1.25 U of HotMaster Taq DNA

polymerase (5 Prime, Inc., Gaithersburg, USA). The PCR conditions were as follows: initial denaturation at 94°C for 5 min, followed by 30 cycles of denaturation at 95°C for 30 s, PCR-product specific annealing temperature (Table 2) for 60 s and extension at 72°C for 60

s, followed by a final elongation for 10 min at 72°C. PCR products were sequenced for identification as described previously [41]. Table 2 Primer sequences and PCR conditions. Primer Oligonucleotide sequence (5′-3′) Nucleotide positions* Annealing temperature Amplicon length Genbank accession no. fimB-550F GGTAAGTGATGGTATTGATGTC 550-571 45 347 AY321316 fimB-875R GTGTTCCTTCTTCCTCAGTATT 875-896       gtf-F GGTGAGACTTGGGTTGATTC 2049-2068 54 496 AB292595 gtf-R GCTCTGCTTGAACAACTGGA 2525-2544       pilB-385F AAGGGACGAGGGCTCTAC 120017-120034 58 339 CP000408 pilB-722R ACCCAATTCCAACATACG 120373-120356       *positions according to the respective Genbank accession no. Statistical analysis Statistical analysis was performed using One-way-ANOVA, the Mann-Whitney-U-test buy BIBF 1120 and the student’s t-test where appropriate. Multiple testing correction was performed using the Bonferroni method. Normality testing of all data sets tetracosactide for Gaussian distribution was performed using the Kolmogorov-Smirnov test. We used Spearman correlation coefficients to assess correlations between variables. P values < 0.01 were considered significant. All values are given as mean values (± SD). Statistical

analysis was performed using GraphPad Prism 4.0 software (GraphPad Software, San Diego, CA, USA). Results Identification of virulence genes and occurrence of intestinal abnormalities All strains analyzed in this study were identified as S. gallolyticus by sequencing analysis of the sodA gene (GenBank accession no. Table 1). Table 1 displays the distribution of the analyzed S. gallolyticus virulence genes fimB, gtf and pilB among 23 different strains. The known virulence gene fimB was detected in all analyzed strains, whereas four strains showed no positive PCR signal for gtf. The occurrence of a partial sequence homolog of the pilB gene, originally identified in S. suis, was proven in 9 strains of S. gallolyticus (GenBank accession no. for S. gallolyticus partial pilB sequence: FJ555059). Sequencing analysis confirmed the gene as pilB with a high similarity of 98% to S. suis pilB.