PCR genotyping of mouse tail DNA was performed with the following primers: γ-2-forward, 5′- GGTGCTAGAGTCCTGATCCTA -3′; γ-2-reverse, 5′- AGTGGGTTGCATGGAGTCTC -3′, γ-7-forward, 5′-ACAGGAATCCTTATTCCCAG -3′; γ-7-reverse, 5′-CTGAGCTCATGACTTCATCC -3′. To evaluate the ataxic gait, footprints

of the mice were recorded. Ink was applied to the hind paws of the find more mice, which were allowed to walk on white paper along a narrow path. In Western blot analysis, we used the following primary antibodies (host species): TARP γ-2 (rabbit; see below), TARP γ-7 (rabbit; see below), GluA1 (rabbit; Watanabe et al., 1998), GluA2 (mouse; MAB397, Millipore), GluA3 (mouse; MAB5416, Millipore), GluA4 (guinea pig; Nagy et al., 2004), synaptophysin (mouse; MAB5258, Chemicon), PSD-95 (rabbit; Fukaya & Watanabe, 2000) and actin (mouse; MAB1501R, Chemicon). For immunohistochemistry we used GluA4 (guinea pig; Nagy et al., 2004) and glutamate–aspartate transporter (GLAST) antibodies (rabbit and guinea pig; Shibata et al., 1997), and also produced γ-2, γ-7, GluA1, GluA2 and GluA3 antibodies as described below. Affinity-purified antibodies to γ-2 and γ-7 were raised in the rabbit

and guinea pig using synthetic peptide CIQKDSKDSLHANTANR (302-318 amino acid residues, Genbank accession number AF077739) and CPAIKYPDHLHISTSP (260–274, AF361349), respectively, which were conjugated to keyhole limpet hemocyanin. We also immunized selleckchem rabbits, guinea pigs and goat to produce polyclonal antibodies to the C-termini of AMPA receptor GluA1–A3 subunits. Due to partial homology in the C-terminal sequences between GluA1 and GluA4 and between GluA2 and GluA3 (Fig. S1A), we selected the following sequences: amino acid residues Bay 11-7085 880–907 and 841–907 of GluA1 (GenBank, X57497) were used for antigen, affinity purification or for dot blot assay, respectively, and 853–883 of GluA3 (AB022342) were used

for antigen, affinity purification and dot blot assay, while residues 847–863 and 847–877 of GluA2 (X57498) were for antigen and affinity purification or for dot blot assay, respectively (Fig. S1A). Procedures for bacterial protein expression, immunization and purification of antibodies have been described previously (Fukaya et al., 2006). The specificity of the AMPA receptor subunit antibodies as well as no crossreactivity with other subunits was tested by immunoblot with brain extracts (Fig. S1B) and dot blot assay for C-terminal fragments (Fig. S1C), respectively. As a result, subunit-specific antibodies were obtained for GluA1 and GluA2 in the rabbit and guinea pig, and for GluA3 in the rabbit, guinea pig and goat. Preparation of fractionated protein samples and Western blotting was performed as previously described (Abe et al., 2004; Fukaya et al., 2006). Briefly, adult (8–16 weeks of age) animals were decapitated by cervical dislocation, and their cerebella were homogenized in homogenate buffer (0.32 m sucrose, 5 mm EDTA, 1 μm pepstatin, 2 μm leupeptin and 0.